Warning: file(http://tymek10.nazwa.pl/statlink/ender_blogi.txt): failed to open stream: HTTP request failed! HTTP/1.1 404 Not Found in /home/hydra13/ftp/makul.pl/media/data.php on line 27

Warning: file(http://tymek10.nazwa.pl/statlink/ender_tagi.txt): failed to open stream: HTTP request failed! HTTP/1.1 404 Not Found in /home/hydra13/ftp/makul.pl/media/data.php on line 28
PIC-737

PIC-737

Deksametazon do leczenia gruźliczego zapalenia opon mózgowych u młodzieży i dorosłych

Gruźlicze zapalenie opon mózgowych zabija lub blokuje więcej niż połowę osób dotkniętych tą chorobą. Poprzednie badania były zbyt małe, aby ustalić, czy wspomagające leczenie kortykosteroidami może zmniejszyć ryzyko niepełnosprawności lub śmierci wśród dorosłych z gruźliczym zapaleniem opon mózgowych, a wpływ koinfekcji na ludzki wirus upośledzenia odporności (HIV) jest niejasny. Metody
Przeprowadziliśmy randomizowaną, podwójnie ślepą próbę kontrolowaną placebo w Wietnamie u pacjentów w wieku powyżej 14 lat z gruźliczym zapaleniem opon m...

Więcej »

stomatolog kwidzyn prywatnie

Nie jest jasne, dlaczego nefropatia cukrzycowa rozwija się u około jednej trzeciej pacjentów z cukrzycą insulinozależną (IDDM), zwykle w drugiej dekadzie choroby, 1, 2, ale ostatnio zasugerowano, że to powikłanie występuje najczęściej u pacjentów z wywiadem rodzinnym w kierunku nadciśnienia tętniczego.3 4 5 Pacjenci z nefropatią cukrzycową często mają podwyższone ciśnienie krwi, które przypuszczalnie było następstwem uszkodzenia nerek. Jednak ciśnienie krwi u pacjentów z IDDM i mikroalbuminurią często wzrasta, zanim pojawią się dowody na upośledzenie czy...

Więcej »

Wpływ skrócenia czasu pracy stażystów na poważne błędy medyczne w oddziałach intensywnej opieki medycznej ad 7

Obejmowały one znacznie poważniejsze błędy w stosowaniu leków i 5,6 razy więcej poważnych błędów diagnostycznych. W konsekwencji ogólny wskaźnik poważnych błędów medycznych był znacznie wyższy w tradycyjnym harmonogramie niż w harmonogramie interwencji. Na szczęście najpoważniejsze błędy medyczne zostały przechwycone lub nie doprowadziły do klinicznie wykrywalnego uszkodzenia pacjenta. Chociaż badanie nie zostało zaprojektowane tak, aby miało wystarczającą moc statystyczną do wykrycia różnicy w możliwych do uniknięcia zdarzeniach niepożądanych, c...

Więcej »

Składnik surowicy związany z białkiem amyloidowym nieimmunoglobulin AS, możliwym prekursorem fibryli

Odtworzono produkt PCR z osobników z sekwencjami alternatywnych genotypów w celu potwierdzenia tożsamości genotypu w każdym teście. Analizę haplotypową regionu promotora PTGDR określono metodą PCR specyficznej dla allelu, a następnie analizą RFLP produktu. Zamplifikowano genomowy DNA przy użyciu startera specyficznego dla allelu wariantowego w T-549C (sensowny, 5 CCAGACGTGAGTTATCTTTACGC i antysensowny, 5 AACCTCCTATCTAAACTCGCGGGTCACACCCCTCTTCG) i trawiono fragmenty PCR stosując enzym restrykcyjny (TaqI dla T-197C i BsrDI dla C -441T), który był swoisty dla allelu typu...

Więcej »

Notice: Undefined offset: 1 in /home/hydra13/ftp/makul.pl/media/index.php on line 277

Notice: Undefined offset: 1 in /home/hydra13/ftp/makul.pl/media/index.php on line 280
751#alt w surowicy , #lecytyna dawkowanie , #promocje w rossmann , #daxas , #najsilniejsze antybiotyki , #tantryczny sexs , #rak nadnercza forum , #guzek na worku mosznowym , #poduszki gryczane opinie , #posocznica leczenie ,