Warning: file(http://tymek10.nazwa.pl/statlink/ender_blogi.txt): failed to open stream: HTTP request failed! HTTP/1.1 404 Not Found in /home/hydra13/ftp/makul.pl/media/data.php on line 27

Warning: file(http://tymek10.nazwa.pl/statlink/ender_tagi.txt): failed to open stream: HTTP request failed! HTTP/1.1 404 Not Found in /home/hydra13/ftp/makul.pl/media/data.php on line 28
popita

popita

Wpływ skrócenia czasu pracy stażystów na poważne błędy medyczne w oddziałach intensywnej opieki medycznej ad 8

Donchin i in. zgłaszali wyższy wskaźnik 1,7 błędu na pacjenta dziennie, ale zawierały błędy o małym potencjale szkodzenia.15 Wskaźniki wykryte przez Donchina i in. może być również wyższy, ponieważ skupił się na błędach w jednostce jako całości, podczas gdy bezpośrednio obserwowaliśmy tylko stażystów. Ponadto w godzinach dziennych, gdy dwóch lub więcej stażystów pracowało jednocześnie w różnych częściach jednostek, nasze ograniczenia dotyczące personelu pozwoliły nam obserwować tylko jednego stażystę na raz. W związku z tym rzeczywisty wskaźnik poważnyc...

Więcej »

Rola wariantów receptorów DP prostanoidu pod względem podatności na astmę czesc 4

Odtworzono produkt PCR z osobników z sekwencjami alternatywnych genotypów w celu potwierdzenia tożsamości genotypu w każdym teście. Analizę haplotypową regionu promotora PTGDR określono metodą PCR specyficznej dla allelu, a następnie analizą RFLP produktu. Zamplifikowano genomowy DNA przy użyciu startera specyficznego dla allelu wariantowego w T-549C (sensowny, 5 CCAGACGTGAGTTATCTTTACGC i antysensowny, 5 AACCTCCTATCTAAACTCGCGGGTCACACCCCTCTTCG) i trawiono fragmenty PCR stosując enzym restrykcyjny (TaqI dla T-197C i BsrDI dla C -441T), który był swoisty dla allelu typu dzikiego. W ...

Więcej »

Rozwiązania medyczne dotyczące nadużyć: Systemy i propozycje rekompensat za szkody cd

Ciekawostką tej podwójnej wady jest fakt, że drobne roszczenia - bez względu na to, jak jasno uzasadnione - są całkowicie zaniedbane. Większość adwokatów powoda nie zaakceptuje przypadku błędu w sztuce lekarskiej, którego wartość odzyskiwalna jest mniejsza niż 50 000 USD. Twierdzenia prawników o głębokiej trosce o ofiary są osłabione ograniczeniem tej troski dla ofiar z bardzo dużymi roszczeniami; ten unikalny amerykański zwyczaj w oczywisty sposób zachęca do coraz większych roszczeń. Autorzy zdają sobie sprawę z tego, że potencjalne niekorzystne błędy w sztuce ...

Więcej »

POMIAR ODLEGŁOŚCI PUNKTÓW NA ŁUKU

Stażyści mieli dzień wolny od pracy, kiedy miała nastąpić zmiana huśtawka w sobotę, niedzielę lub poniedziałek (np. Niedziela dla stażystki 1). Stażyści odwiedzali kliniki tylko wtedy, gdy zbiegali się z dniem swingowania. We współpracy z kierownictwem programu rezydencji i kierowników jednostek opracowaliśmy harmonogram prac interwencyjnych dla stażystów, który wyeliminował wydłużone (24 godziny lub więcej) zmiany w pracy i zredukował liczbę zaplanowanych godzin pracy do 63 na tydzień (rysunek 1). Tradycyjna ekipa pracowników MICU składała się z trzech stażyst...

Więcej »
http://www.zdrowezeby.com.pl 751# , #oparzenie pęcherz , #facet w spódnicy , #obrzezanie napletka , #spojenie łonowe ból , #ostropest forum , #ból żołądka i wzdęcia , #obkurczenie , #co stosować na hemoroidy , #alt w surowicy ,