Warning: file(http://tymek10.nazwa.pl/statlink/ender_blogi.txt): failed to open stream: HTTP request failed! HTTP/1.1 404 Not Found in /home/hydra13/ftp/makul.pl/media/data.php on line 27

Warning: file(http://tymek10.nazwa.pl/statlink/ender_tagi.txt): failed to open stream: HTTP request failed! HTTP/1.1 404 Not Found in /home/hydra13/ftp/makul.pl/media/data.php on line 28
lek na biegunkę dla niemowląt

lek na biegunkę dla niemowląt

Staphylococcus aureus Przewód donosowy i infekcja u pacjentów z ciągłą ambulatoryjną dializą otrzewnową

Znaczenie Staphylococcus aureus jako czynnika etiologicznego zakażenia miejsca wyjścia w ciągłej ambulatoryjnej dializie otrzewnowej (CAPD) zostało dobrze ustalone.1 2 3 4 Ostatnie badania wykazały, że infekcje osierdziowe są główną przyczyną niepowodzenia cewników CAPD. Piraino i in. donoszą, że zakażenie w miejscu wyjścia, niezależnie od zapalenia otrzewnej, było odpowiedzialne za 57 procent kaniuli usuniętych podczas pięcioletniego okresu.5 Zimm...

Więcej »

Rola wariantów receptorów DP prostanoidu pod względem podatności na astmę czesc 4

Odtworzono produkt PCR z osobników z sekwencjami alternatywnych genotypów w celu potwierdzenia tożsamości genotypu w każdym teście. Analizę haplotypową regionu promotora PTGDR określono metodą PCR specyficznej dla allelu, a następnie analizą RFLP produktu. Zamplifikowano genomowy DNA przy użyciu startera specyficznego dla allelu wariantowego w T-549C (sensowny, 5 CCAGACGTGAGTTATCTTTACGC i antysensowny, 5 AACCTCCTATCTAAACTCGCGGGTCACACCCCTCTTCG) i trawiono ...

Więcej »

Cechy kliniczne i czynniki prognostyczne u dorosłych z bakteryjnym zapaleniem opon mózgowych

Przeprowadziliśmy ogólnokrajowe badanie w Holandii, aby określić cechy kliniczne i czynniki prognostyczne u dorosłych z ostrym bakteryjnym zapaleniem opon mózgowych. Metody
Od października 1998 r. Do kwietnia 2002 r. Wszyscy holenderscy pacjenci z ostrym bakteryjnym zapaleniem opon mózgowych potwierdzonym przez hodowle w płynie mózgowo-rdzeniowym byli oceniani prospektywnie. Wszyscy pacjenci przeszli badanie neurologiczne przy przyjęciu i przy wypisi...

Więcej »

Dekodowanie ciemności: poszukiwanie genetycznych przyczyn choroby Alzheimera

Początkującym reporterom nauki dobrze byłoby przeczytać Sortowanie przez plewę autorstwa Kotulaka. Zagrożenia dla zdrowia i prasa nie są dobrze związane; samo otwarcie jednej kopii prawie zerwało osłonę. Jest jednak dobrze zredagowany: eseje są czytelne i odpowiednio spójne pod względem formatu i nawiązują do siebie nawzajem. Znaczna część treści pojawiła się gdzie indziej. Dotyczy to na przykład materiału autorstwa Amesa na temat nieporozumi...

Więcej »
http://www.dentysta-krakow.info.pl 751#facet w spódnicy , #obrzezanie napletka , #spojenie łonowe ból , #ostropest forum , #ból żołądka i wzdęcia , #obkurczenie , #co stosować na hemoroidy , #alt w surowicy , #lecytyna dawkowanie , #promocje w rossmann ,