Rola wariantów receptorów DP prostanoidu pod względem podatności na astmę czesc 4

Odtworzono produkt PCR z osobników z sekwencjami alternatywnych genotypów w celu potwierdzenia tożsamości genotypu w każdym teście. Analizę haplotypową regionu promotora PTGDR określono metodą PCR specyficznej dla allelu, a następnie analizą RFLP produktu. Zamplifikowano genomowy DNA przy użyciu startera specyficznego dla allelu wariantowego w T-549C (sensowny, 5 CCAGACGTGAGTTATCTTTACGC i antysensowny, 5 AACCTCCTATCTAAACTCGCGGGTCACACCCCTCTTCG) i trawiono fragmenty PCR stosując enzym restrykcyjny (TaqI dla T-197C i BsrDI dla C -441T), który był swoisty dla allelu typu dzikiego. W każdym teście kontrole znanej sekwencji były prawidłowo identyfikowane, a wyniki potwierdzono przez sekwencjonowanie podgrupy próbek.
Oznaczenie immunoprecypitacji chromatyny
Oznaczenia immunoprecypitacji chromatyny przeprowadzono zgodnie z metodą Boyda i wsp.19 przy użyciu dostępnego na rynku zestawu (Upstate) na ekstraktach jądrowych z komórek KU812 i eozynofilach z krwi obwodowej wyizolowanych metodą wirowania z gradientem gęstości i immunomagnetycznym selekcją CD16-ujemnym. Read more „Rola wariantów receptorów DP prostanoidu pod względem podatności na astmę czesc 4”

Deksametazon do leczenia gruźliczego zapalenia opon mózgowych u młodzieży i dorosłych ad

Autorzy doszli do wniosku, że niewielka liczba pacjentów, słabe ukrywanie przypisań do grup terapeutycznych i stronniczość publikacji może wyjaśniać pozytywne wyniki, oraz badania u pacjentów z zakażeniem wirusem HIV i badania o rozmiarze wystarczającym do oceny chorobowości i przypadku śmiertelności. stawka była wymagana.11 Dlatego przeprowadziliśmy podwójnie ślepe, kontrolowane placebo badanie, aby ustalić, czy terapia uzupełniająca deksametazonem poprawia wyniki u pacjentów w wieku powyżej 14 lat z gruźliczym zapaleniem opon mózgowo-rdzeniowych z zakażeniem HIV lub bez niego. Metody
Uczestnicy badania
Zwerbowaliśmy uczestników badania z dwóch ośrodków w Ho Chi Minh City w Wietnamie: Pham Ngoc Thach Hospital w Gruźlicy i Chorób Płuc oraz Szpitala Chorób Tropikalnych. Te 500-osobowe szpitale służą lokalnej społeczności i działają jako trzeciorzędne centra referencyjne dla pacjentów z ciężką gruźlicą (Pham Ngoc Thach Hospital) lub chorób zakaźnych (szpital dla chorób tropikalnych) w południowym Wietnamie.
Tylko pacjenci w wieku powyżej 14 lat z klinicznymi objawami zapalenia opon mózgowych (zdefiniowanymi jako połączenie sztywności karku i zaburzeń płynu mózgowo-rdzeniowego) kwalifikowali się do udziału w badaniu. Read more „Deksametazon do leczenia gruźliczego zapalenia opon mózgowych u młodzieży i dorosłych ad”

Przedoperacyjna i pooperacyjna chemioradioterapia raka odbytnicy

Pooperacyjna chemioradioterapia jest zalecaną standardową terapią u pacjentów z miejscowo zaawansowanym rakiem odbytnicy. W ostatnich latach odnotowano zachęcające wyniki przedoperacyjnej radioterapii. Porównaliśmy przedoperacyjną chemioradioterapię z pooperacyjną chemioradioterapią miejscowo zaawansowanego raka odbytnicy. Metody
Losowo przydzieliliśmy pacjentów z klinicznym stadium T3 lub T4 lub chorobą z dodatnim węzłem chłonnym, którzy otrzymywali przedoperacyjną lub pooperacyjną chemioradioterapię. Przedoperacyjne leczenie obejmowało 5040 cGy podawanych we frakcjach 180 cGy na dobę, pięć dni w tygodniu i fluorouracyl, podawane w 120-godzinnym ciągłym wlewie dożylnym w dawce 1000 mg na metr kwadratowy powierzchni ciała dziennie w ciągu pierwszy i piąty tydzień radioterapii. Read more „Przedoperacyjna i pooperacyjna chemioradioterapia raka odbytnicy”

Próba różnych intensywności leczenia przeciwzakrzepowego u pacjentów z protezowymi zaworami serca cd

Badanymi zmiennymi były intensywność antykoagulacji, czas trwania leczenia oraz wiek, płeć i historia palenia, cukrzyca i migotanie przedsionków. Ponieważ żaden z pacjentów nie miał nadciśnienia, nie został uwzględniony w ostatecznej analizie. Względne ryzyko uzyskano ze współczynnika logistyczno-regresyjnego. Wyniki
Pacjenci
Tabela 1. Tabela 1. Read more „Próba różnych intensywności leczenia przeciwzakrzepowego u pacjentów z protezowymi zaworami serca cd”

Próba różnych intensywności leczenia przeciwzakrzepowego u pacjentów z protezowymi zaworami serca

THROMBOSIS wpływające na zastawki serca i tętnicze zakrzepowo-zatorowe pozostają głównymi przyczynami późnej zachorowalności i umieralności po zastąpieniu zastawek serca mechanicznymi protezami, pomimo ulepszenia konstrukcji zastawki.1 Czynniki wpływające na ryzyko wystąpienia tętniczej choroby zakrzepowo-zatorowej obejmują typ, miejsce i liczbę zastąpionych zastawek, 2 3 4 5 obecność lub brak migotania przedsionków, 6 leczenie warfaryną lub innymi doustnymi antykoagulantami, adekwatność terapii warfaryną, oraz dodanie leków przeciwpłytkowych, takich jak dipirydamol i aspiryna.1
Chociaż potrzeba leczenia przez całe życie warfaryny po mechanicznej wymianie zastawek, szczególnie w miejscu mitralnym (i prawdopodobnie w miejscu aorty), jest obecnie powszechnie akceptowana, pozostaje niepewność co do jej optymalnej intensywności.4, 7, 8 Ponieważ badania retrospektywne zdecydowanie sugerują że choroba zakrzepowo-zatorowa jest znacznie bardziej prawdopodobna, gdy efekt warfaryny jest niski lub nieobecny, zazwyczaj zalecano 7, 9 10 11 bardziej niż mniej intensywną terapię. W Europie terapia zwykle ma na celu międzynarodowy współczynnik znormalizowany (system standaryzacji wyników testów czasu protrombinowego wykonywanych z różnymi odczynnikami) od 3,0 do 5,0, aw Ameryce Północnej ma on na celu jeszcze wyższe poziomy, 12 jednak ostatnio wydaje się, że być zgodą na międzynarodowy znormalizowany stosunek pomiędzy 3,0 a 4,5 u pacjentów z mechaniczną zastawką protetyczną.13 Pytanie jest zarówno ważne, jak i aktualne, ponieważ ryzyko krwawienia wzrasta wraz z wyższymi poziomami antykoagulacji, a ponieważ badania z randomizacją wykazały, że profilaktyka wtórna po zakrzepicy żylnej wymaga mniej intensywnego efektu przeciwzakrzepowego (międzynarodowy współczynnik znormalizowany, od 2,0 do 2,5), niż wcześniej sądzono.
Przeprowadziliśmy prospektywne, otwarte badanie kliniczne, w którym pacjenci z zastawkami zastawki serca zostali losowo przydzieleni do terapii zaprojektowanej w celu uzyskania jednego z dwóch poziomów działania przeciwzakrzepowego: stosunek protrombiny do czasu (stosunek czasu protrombinowego pacjenta do czasu puli normalnej plazmy ) 1,5 (międzynarodowy współczynnik znormalizowany, 2,65) lub stosunek protrombinowy w czasie 2,5 (międzynarodowy współczynnik znormalizowany, 9). Wartości te odpowiadają skrajności przyjętego zakresu terapeutycznego w wielu ośrodkach15, 16
Metody
Pacjenci
Wszyscy pacjenci, którzy otrzymali mechaniczne zastawki protetyczne z powodu reumatycznej choroby serca i brali udział w klinice antykoagulacyjnej w latach 1981-1985 zostali losowo przydzieleni do jednej z dwóch grup terapeutycznych, które różniły się jedynie zamierzonym poziomem działania przeciwzakrzepowego (umiarkowane lub wysokie). Nie było żadnych wyjątków. Read more „Próba różnych intensywności leczenia przeciwzakrzepowego u pacjentów z protezowymi zaworami serca”

Wiadomości i numery: Przewodnik po zgłaszaniu roszczeń statystycznych i kontrowersji w dziedzinie zdrowia i dziedzin pokrewnych Zagrożenia dla zdrowia i prasa: Perspektywy medialnego zakresu oceny ryzyka i zdrowia ad

Początkującym reporterom nauki dobrze byłoby przeczytać Sortowanie przez plewę autorstwa Kotulaka. Zagrożenia dla zdrowia i prasa nie są dobrze związane; samo otwarcie jednej kopii prawie zerwało osłonę. Jest jednak dobrze zredagowany: eseje są czytelne i odpowiednio spójne pod względem formatu i nawiązują do siebie nawzajem. Znaczna część treści pojawiła się gdzie indziej. Dotyczy to na przykład materiału autorstwa Amesa na temat nieporozumień na temat zanieczyszczenia i raka, przez Nelkina na temat tego, jak prasa obejmuje naukę, oraz Cohna na temat oceny twierdzeń naukowców. Read more „Wiadomości i numery: Przewodnik po zgłaszaniu roszczeń statystycznych i kontrowersji w dziedzinie zdrowia i dziedzin pokrewnych Zagrożenia dla zdrowia i prasa: Perspektywy medialnego zakresu oceny ryzyka i zdrowia ad”

Pomyślna alogeniczna transplantacja zubożonego w komórki T szpiku kostnego z blisko dopasowanych HLA niespokrewnionych dawców ad 6

ANC oznacza bezwzględną liczbę neutrofilów. Na wykresie po lewej stronie w panelu B kropki przedstawiają liczbę komórek szpiku uzyskanych od dawcy (pod względem masy biorcy); na wykresie po prawej stronie kropki przedstawiają komórki zarodkowe szpiku kostnego podawane po rozdzieleniu komórek jednojądrzastych i wyczerpaniu limfocytów T. I słupki oznaczają średnie . SD. Diamenty reprezentują dawkę szpiku u pacjentów z niewydolnością przeszczepu: diament 1, pacjenci z niedokrwienną przeszczepioną przez stronę trzecią ; i diamenty 2 i 3, pacjenci z odrzuceniem za pośrednictwem komórki gospodarza. Read more „Pomyślna alogeniczna transplantacja zubożonego w komórki T szpiku kostnego z blisko dopasowanych HLA niespokrewnionych dawców ad 6”

Pomyślna alogeniczna transplantacja zubożonego w komórki T szpiku kostnego z blisko dopasowanych HLA niespokrewnionych dawców ad

Jeśli genotypowo identyczny pod względem HLA dawcy-rodzeństwa lub odpowiedni blisko powiązany pokrewny dawcy nie był dostępny, rozpoczęto poszukiwanie niespokrewnionego dawcy zgodnie z kryteriami dopasowywania potencjalnych dawców i biorców. Pacjenci kwalifikowali się do przeszczepu od niepowiązanych dawców, jeśli mieli mniej niż 50 lat i mieli albo choroby nowotworowe, albo potencjalnie letalne choroby nienowotworowe. Pacjenci z nabytą anemią aplastyczną mieli niepowodzenie leczenia co najmniej jednego cyklu globuliny antyitocytarnej. Uzyskano świadomą zgodę od pacjentów (lub ich opiekunów), a wszystkie terapie były prowadzone zgodnie z protokołami zatwierdzonymi przez odpowiednie komitety ds. Przeglądu instytucjonalnego dotyczące badań na ludziach. Read more „Pomyślna alogeniczna transplantacja zubożonego w komórki T szpiku kostnego z blisko dopasowanych HLA niespokrewnionych dawców ad”

Staphylococcus aureus Przewód donosowy i infekcja u pacjentów z ciągłą ambulatoryjną dializą otrzewnową ad 6

Ta możliwość może wyjaśnić dwa epizody zakażenia miejsca wyjściowego wywoływanego przez organizm u pacjentów, którzy pierwotnie zostali zaklasyfikowani jako nosiciele. W przypadku jednego z nosicieli, S. aureus hodowano zarodników na dwa miesiące przed odkryciem infekcji w miejscu wyjścia przez ten sam organizm, co oceniono na podstawie typu fagowego. Jedno z naszych centrów otrzymało kultury przed CAPD jednocześnie z przednich brzegów, pachwin i brzucha uczestniczących pacjentów. Najbardziej czułe okazały się hodowle donosowe (możliwe było hodowanie S. Read more „Staphylococcus aureus Przewód donosowy i infekcja u pacjentów z ciągłą ambulatoryjną dializą otrzewnową ad 6”

Staphylococcus aureus Przewód donosowy i infekcja u pacjentów z ciągłą ambulatoryjną dializą otrzewnową cd

Rozpoznanie infekcji tunelowej stwierdzono, jeśli wystąpił rumień, obrzęk lub tkliwość w tunelu podskórnym, z wypływem lub bez oraz z dodatnią hodowlą. Liczbę komórek przeprowadzono w dializacie, gdy występowała gorączka, tkliwość, ból brzucha lub mętny dializat. Zapalenie otrzewnej definiowano jako liczbę leukocytów w dializacie wynoszącą ponad 100 komórek na milimetr sześcienny, przy czym ponad 50% tych komórek stanowią leukocyty polimorfojądrowe. Uważano, że pacjenci mieli nowe epizody zakażenia tym samym organizmem, jeśli nie mieli objawów po zakończeniu antybiotykoterapii i jeśli objawy infekcji powróciły ponad cztery tygodnie po wystąpieniu poprzedzającej infekcji. Leczenie zakażenia miejsca rzutu, infekcji tunelowej i zapalenia otrzewnej
Infekcje były leczone zgodnie z rutynowymi protokołami ustalonymi przez każdy szpital. Read more „Staphylococcus aureus Przewód donosowy i infekcja u pacjentów z ciągłą ambulatoryjną dializą otrzewnową cd”