Rola wariantów receptorów DP prostanoidu pod względem podatności na astmę czesc 4

Odtworzono produkt PCR z osobników z sekwencjami alternatywnych genotypów w celu potwierdzenia tożsamości genotypu w każdym teście. Analizę haplotypową regionu promotora PTGDR określono metodą PCR specyficznej dla allelu, a następnie analizą RFLP produktu. Zamplifikowano genomowy DNA przy użyciu startera specyficznego dla allelu wariantowego w T-549C (sensowny, 5 CCAGACGTGAGTTATCTTTACGC i antysensowny, 5 AACCTCCTATCTAAACTCGCGGGTCACACCCCTCTTCG) i trawiono fragmenty PCR stosując enzym restrykcyjny (TaqI dla T-197C i BsrDI dla C -441T), który był swoisty dla allelu typu dzikiego. W każdym teście kontrole znanej sekwencji były prawidłowo identyfikowane, a wyniki potwierdzono przez sekwencjonowanie podgrupy próbek.
Oznaczenie immunoprecypitacji chromatyny
Oznaczenia immunoprecypitacji chromatyny przeprowadzono zgodnie z metodą Boyda i wsp.19 przy użyciu dostępnego na rynku zestawu (Upstate) na ekstraktach jądrowych z komórek KU812 i eozynofilach z krwi obwodowej wyizolowanych metodą wirowania z gradientem gęstości i immunomagnetycznym selekcją CD16-ujemnym. Read more „Rola wariantów receptorów DP prostanoidu pod względem podatności na astmę czesc 4”

Deksametazon do leczenia gruźliczego zapalenia opon mózgowych u młodzieży i dorosłych ad

Autorzy doszli do wniosku, że niewielka liczba pacjentów, słabe ukrywanie przypisań do grup terapeutycznych i stronniczość publikacji może wyjaśniać pozytywne wyniki, oraz badania u pacjentów z zakażeniem wirusem HIV i badania o rozmiarze wystarczającym do oceny chorobowości i przypadku śmiertelności. stawka była wymagana.11 Dlatego przeprowadziliśmy podwójnie ślepe, kontrolowane placebo badanie, aby ustalić, czy terapia uzupełniająca deksametazonem poprawia wyniki u pacjentów w wieku powyżej 14 lat z gruźliczym zapaleniem opon mózgowo-rdzeniowych z zakażeniem HIV lub bez niego. Metody
Uczestnicy badania
Zwerbowaliśmy uczestników badania z dwóch ośrodków w Ho Chi Minh City w Wietnamie: Pham Ngoc Thach Hospital w Gruźlicy i Chorób Płuc oraz Szpitala Chorób Tropikalnych. Te 500-osobowe szpitale służą lokalnej społeczności i działają jako trzeciorzędne centra referencyjne dla pacjentów z ciężką gruźlicą (Pham Ngoc Thach Hospital) lub chorób zakaźnych (szpital dla chorób tropikalnych) w południowym Wietnamie.
Tylko pacjenci w wieku powyżej 14 lat z klinicznymi objawami zapalenia opon mózgowych (zdefiniowanymi jako połączenie sztywności karku i zaburzeń płynu mózgowo-rdzeniowego) kwalifikowali się do udziału w badaniu. Read more „Deksametazon do leczenia gruźliczego zapalenia opon mózgowych u młodzieży i dorosłych ad”

Przedoperacyjna i pooperacyjna chemioradioterapia raka odbytnicy

Pooperacyjna chemioradioterapia jest zalecaną standardową terapią u pacjentów z miejscowo zaawansowanym rakiem odbytnicy. W ostatnich latach odnotowano zachęcające wyniki przedoperacyjnej radioterapii. Porównaliśmy przedoperacyjną chemioradioterapię z pooperacyjną chemioradioterapią miejscowo zaawansowanego raka odbytnicy. Metody
Losowo przydzieliliśmy pacjentów z klinicznym stadium T3 lub T4 lub chorobą z dodatnim węzłem chłonnym, którzy otrzymywali przedoperacyjną lub pooperacyjną chemioradioterapię. Przedoperacyjne leczenie obejmowało 5040 cGy podawanych we frakcjach 180 cGy na dobę, pięć dni w tygodniu i fluorouracyl, podawane w 120-godzinnym ciągłym wlewie dożylnym w dawce 1000 mg na metr kwadratowy powierzchni ciała dziennie w ciągu pierwszy i piąty tydzień radioterapii. Read more „Przedoperacyjna i pooperacyjna chemioradioterapia raka odbytnicy”

Przedoperacyjna i pooperacyjna chemioradioterapia raka odbytnicy ad 8

Chociaż ta ostatnia hipoteza została jednoznacznie potwierdzona, nie można było wykazać statystycznie istotnej różnicy w częstości występowania odległych nawrotów lub w odsetku przeżycia wolnego od choroby lub całkowitego przeżycia. Biorąc pod uwagę, że odsetek wznów miejscowych po przedoperacyjnej chemioradioterapii i całkowitym wycięciu mezorektalnym wynosił tylko 6 procent, możliwe jest, że dalsze postępy w zapobieganiu odległym nawrotom mogą być osiągnięte dzięki skuteczniejszej chemioterapii. Faza i 2 prób przedoperacyjnej radioterapii z jednoczesną kapecytabiną i oksaliplatyną zostały zakończone przez naszą grupę.16 Ten schemat leczenia skojarzonego powinien być testowany w oparciu o standardową chemioradioterapię fluorouracylem w kolejnych badaniach. Wraz z rosnącym stosowaniem leczenia przedoperacyjnego u chorych na raka odbytnicy konieczne jest dokładne ustalenie stopnia zaawansowania, aby uniknąć niepotrzebnego leczenia nowotworów we wczesnym stadium. Szacuje się, że dokładność ultrasonografii endorektalnej wynosi od 67 do 93 procent dla oceny penetracji ściany-ściany i od 62 do 83 procent dla określenia stanu węzłowego.17 W naszym badaniu, ultrasonografia endorektalna była obowiązkowa dla oceny guza przed leczeniem. Read more „Przedoperacyjna i pooperacyjna chemioradioterapia raka odbytnicy ad 8”

Rozwiązania medyczne dotyczące nadużyć: Systemy i propozycje rekompensat za szkody

Podczas gdy kilka książek ostatnio omawianych w tych kolumnach próbowało przejrzeć lub wydać zalecenia dotyczące enigmy dotyczącej medycznych błędów w sztuce w Stanach Zjednoczonych, niewielu zrobiło to tak dobrze jak ta. Oto książka, która formułuje zalecenia, przy niewielkiej liczbie przeglądów; mało tu jest zwykłej gadatliwości dotyczącej historii i etyki, moralności i edukacji, kontroli prawnych lub złych uczynków lekarzy, branży ubezpieczeniowej lub prawników. Redaktorzy pochodzą z Midwest Institute of Health Care and Law w Topeka, Kansas. Wszyscy mają wyższe wykształcenie lub wydziały, a dwóch to lekarze. Ich 11 współpracowników pochodzi z kilku innych stanów, a także z Wielkiej Brytanii i Nowej Zelandii. Read more „Rozwiązania medyczne dotyczące nadużyć: Systemy i propozycje rekompensat za szkody”

Randomizowany proces chirurgii w leczeniu pojedynczych przerzutów do mózgu ad 8

Niepowodzenia leczenia są dwojakiego rodzaju: nawroty w pierwotnym miejscu i nowe przerzuty w miejscach w mózgu innych niż pierwotny (odległe przerzuty). Przyczyny dwóch rodzajów awarii są prawdopodobnie inne. Nawrót w pierwotnym miejscu jest prawie na pewno spowodowany niepowodzeniem początkowego leczenia, aby całkowicie wyeliminować pierwotne przerzuty. Nawroty w odległych miejscach w mózgu mogą wynikać z nowych przerzutów rozprzestrzeniających się do mózgu po zakończeniu leczenia pierwotnego guza mózgu lub z obecności dodatkowych (ale niewykrytych) przerzutów do mózgu, które były obecne, ale nie zostały zniszczone przez radioterapię w tym czasie. pierwotne przerzuty do mózgu poddano leczeniu. Read more „Randomizowany proces chirurgii w leczeniu pojedynczych przerzutów do mózgu ad 8”

Staphylococcus aureus Przewód donosowy i infekcja u pacjentów z ciągłą ambulatoryjną dializą otrzewnową cd

Rozpoznanie infekcji tunelowej stwierdzono, jeśli wystąpił rumień, obrzęk lub tkliwość w tunelu podskórnym, z wypływem lub bez oraz z dodatnią hodowlą. Liczbę komórek przeprowadzono w dializacie, gdy występowała gorączka, tkliwość, ból brzucha lub mętny dializat. Zapalenie otrzewnej definiowano jako liczbę leukocytów w dializacie wynoszącą ponad 100 komórek na milimetr sześcienny, przy czym ponad 50% tych komórek stanowią leukocyty polimorfojądrowe. Uważano, że pacjenci mieli nowe epizody zakażenia tym samym organizmem, jeśli nie mieli objawów po zakończeniu antybiotykoterapii i jeśli objawy infekcji powróciły ponad cztery tygodnie po wystąpieniu poprzedzającej infekcji. Leczenie zakażenia miejsca rzutu, infekcji tunelowej i zapalenia otrzewnej
Infekcje były leczone zgodnie z rutynowymi protokołami ustalonymi przez każdy szpital. Read more „Staphylococcus aureus Przewód donosowy i infekcja u pacjentów z ciągłą ambulatoryjną dializą otrzewnową cd”

Pomyślna alogeniczna transplantacja zubożonego w komórki T szpiku kostnego z blisko dopasowanych HLA niespokrewnionych dawców ad

Jeśli genotypowo identyczny pod względem HLA dawcy-rodzeństwa lub odpowiedni blisko powiązany pokrewny dawcy nie był dostępny, rozpoczęto poszukiwanie niespokrewnionego dawcy zgodnie z kryteriami dopasowywania potencjalnych dawców i biorców. Pacjenci kwalifikowali się do przeszczepu od niepowiązanych dawców, jeśli mieli mniej niż 50 lat i mieli albo choroby nowotworowe, albo potencjalnie letalne choroby nienowotworowe. Pacjenci z nabytą anemią aplastyczną mieli niepowodzenie leczenia co najmniej jednego cyklu globuliny antyitocytarnej. Uzyskano świadomą zgodę od pacjentów (lub ich opiekunów), a wszystkie terapie były prowadzone zgodnie z protokołami zatwierdzonymi przez odpowiednie komitety ds. Przeglądu instytucjonalnego dotyczące badań na ludziach. Read more „Pomyślna alogeniczna transplantacja zubożonego w komórki T szpiku kostnego z blisko dopasowanych HLA niespokrewnionych dawców ad”

Staphylococcus aureus Przewód donosowy i infekcja u pacjentów z ciągłą ambulatoryjną dializą otrzewnową ad 6

Ta możliwość może wyjaśnić dwa epizody zakażenia miejsca wyjściowego wywoływanego przez organizm u pacjentów, którzy pierwotnie zostali zaklasyfikowani jako nosiciele. W przypadku jednego z nosicieli, S. aureus hodowano zarodników na dwa miesiące przed odkryciem infekcji w miejscu wyjścia przez ten sam organizm, co oceniono na podstawie typu fagowego. Jedno z naszych centrów otrzymało kultury przed CAPD jednocześnie z przednich brzegów, pachwin i brzucha uczestniczących pacjentów. Najbardziej czułe okazały się hodowle donosowe (możliwe było hodowanie S. Read more „Staphylococcus aureus Przewód donosowy i infekcja u pacjentów z ciągłą ambulatoryjną dializą otrzewnową ad 6”

Pomyślna alogeniczna transplantacja zubożonego w komórki T szpiku kostnego z blisko dopasowanych HLA niespokrewnionych dawców ad 6

ANC oznacza bezwzględną liczbę neutrofilów. Na wykresie po lewej stronie w panelu B kropki przedstawiają liczbę komórek szpiku uzyskanych od dawcy (pod względem masy biorcy); na wykresie po prawej stronie kropki przedstawiają komórki zarodkowe szpiku kostnego podawane po rozdzieleniu komórek jednojądrzastych i wyczerpaniu limfocytów T. I słupki oznaczają średnie . SD. Diamenty reprezentują dawkę szpiku u pacjentów z niewydolnością przeszczepu: diament 1, pacjenci z niedokrwienną przeszczepioną przez stronę trzecią ; i diamenty 2 i 3, pacjenci z odrzuceniem za pośrednictwem komórki gospodarza. Read more „Pomyślna alogeniczna transplantacja zubożonego w komórki T szpiku kostnego z blisko dopasowanych HLA niespokrewnionych dawców ad 6”