Rola wariantów receptorów DP prostanoidu pod względem podatności na astmę czesc 4

Odtworzono produkt PCR z osobników z sekwencjami alternatywnych genotypów w celu potwierdzenia tożsamości genotypu w każdym teście. Analizę haplotypową regionu promotora PTGDR określono metodą PCR specyficznej dla allelu, a następnie analizą RFLP produktu. Zamplifikowano genomowy DNA przy użyciu startera specyficznego dla allelu wariantowego w T-549C (sensowny, 5 CCAGACGTGAGTTATCTTTACGC i antysensowny, 5 AACCTCCTATCTAAACTCGCGGGTCACACCCCTCTTCG) i trawiono fragmenty PCR stosując enzym restrykcyjny (TaqI dla T-197C i BsrDI dla C -441T), który był swoisty dla allelu typu dzikiego. W każdym teście kontrole znanej sekwencji były prawidłowo identyfikowane, a wyniki potwierdzono przez sekwencjonowanie podgrupy próbek.
Oznaczenie immunoprecypitacji chromatyny
Oznaczenia immunoprecypitacji chromatyny przeprowadzono zgodnie z metodą Boyda i wsp.19 przy użyciu dostępnego na rynku zestawu (Upstate) na ekstraktach jądrowych z komórek KU812 i eozynofilach z krwi obwodowej wyizolowanych metodą wirowania z gradientem gęstości i immunomagnetycznym selekcją CD16-ujemnym. Read more „Rola wariantów receptorów DP prostanoidu pod względem podatności na astmę czesc 4”

Deksametazon do leczenia gruźliczego zapalenia opon mózgowych u młodzieży i dorosłych ad

Autorzy doszli do wniosku, że niewielka liczba pacjentów, słabe ukrywanie przypisań do grup terapeutycznych i stronniczość publikacji może wyjaśniać pozytywne wyniki, oraz badania u pacjentów z zakażeniem wirusem HIV i badania o rozmiarze wystarczającym do oceny chorobowości i przypadku śmiertelności. stawka była wymagana.11 Dlatego przeprowadziliśmy podwójnie ślepe, kontrolowane placebo badanie, aby ustalić, czy terapia uzupełniająca deksametazonem poprawia wyniki u pacjentów w wieku powyżej 14 lat z gruźliczym zapaleniem opon mózgowo-rdzeniowych z zakażeniem HIV lub bez niego. Metody
Uczestnicy badania
Zwerbowaliśmy uczestników badania z dwóch ośrodków w Ho Chi Minh City w Wietnamie: Pham Ngoc Thach Hospital w Gruźlicy i Chorób Płuc oraz Szpitala Chorób Tropikalnych. Te 500-osobowe szpitale służą lokalnej społeczności i działają jako trzeciorzędne centra referencyjne dla pacjentów z ciężką gruźlicą (Pham Ngoc Thach Hospital) lub chorób zakaźnych (szpital dla chorób tropikalnych) w południowym Wietnamie.
Tylko pacjenci w wieku powyżej 14 lat z klinicznymi objawami zapalenia opon mózgowych (zdefiniowanymi jako połączenie sztywności karku i zaburzeń płynu mózgowo-rdzeniowego) kwalifikowali się do udziału w badaniu. Read more „Deksametazon do leczenia gruźliczego zapalenia opon mózgowych u młodzieży i dorosłych ad”

Przedoperacyjna i pooperacyjna chemioradioterapia raka odbytnicy

Pooperacyjna chemioradioterapia jest zalecaną standardową terapią u pacjentów z miejscowo zaawansowanym rakiem odbytnicy. W ostatnich latach odnotowano zachęcające wyniki przedoperacyjnej radioterapii. Porównaliśmy przedoperacyjną chemioradioterapię z pooperacyjną chemioradioterapią miejscowo zaawansowanego raka odbytnicy. Metody
Losowo przydzieliliśmy pacjentów z klinicznym stadium T3 lub T4 lub chorobą z dodatnim węzłem chłonnym, którzy otrzymywali przedoperacyjną lub pooperacyjną chemioradioterapię. Przedoperacyjne leczenie obejmowało 5040 cGy podawanych we frakcjach 180 cGy na dobę, pięć dni w tygodniu i fluorouracyl, podawane w 120-godzinnym ciągłym wlewie dożylnym w dawce 1000 mg na metr kwadratowy powierzchni ciała dziennie w ciągu pierwszy i piąty tydzień radioterapii. Read more „Przedoperacyjna i pooperacyjna chemioradioterapia raka odbytnicy”

Przedoperacyjna i pooperacyjna chemioradioterapia raka odbytnicy ad 8

Chociaż ta ostatnia hipoteza została jednoznacznie potwierdzona, nie można było wykazać statystycznie istotnej różnicy w częstości występowania odległych nawrotów lub w odsetku przeżycia wolnego od choroby lub całkowitego przeżycia. Biorąc pod uwagę, że odsetek wznów miejscowych po przedoperacyjnej chemioradioterapii i całkowitym wycięciu mezorektalnym wynosił tylko 6 procent, możliwe jest, że dalsze postępy w zapobieganiu odległym nawrotom mogą być osiągnięte dzięki skuteczniejszej chemioterapii. Faza i 2 prób przedoperacyjnej radioterapii z jednoczesną kapecytabiną i oksaliplatyną zostały zakończone przez naszą grupę.16 Ten schemat leczenia skojarzonego powinien być testowany w oparciu o standardową chemioradioterapię fluorouracylem w kolejnych badaniach. Wraz z rosnącym stosowaniem leczenia przedoperacyjnego u chorych na raka odbytnicy konieczne jest dokładne ustalenie stopnia zaawansowania, aby uniknąć niepotrzebnego leczenia nowotworów we wczesnym stadium. Szacuje się, że dokładność ultrasonografii endorektalnej wynosi od 67 do 93 procent dla oceny penetracji ściany-ściany i od 62 do 83 procent dla określenia stanu węzłowego.17 W naszym badaniu, ultrasonografia endorektalna była obowiązkowa dla oceny guza przed leczeniem. Read more „Przedoperacyjna i pooperacyjna chemioradioterapia raka odbytnicy ad 8”

Rozwiązania medyczne dotyczące nadużyć: Systemy i propozycje rekompensat za szkody

Podczas gdy kilka książek ostatnio omawianych w tych kolumnach próbowało przejrzeć lub wydać zalecenia dotyczące enigmy dotyczącej medycznych błędów w sztuce w Stanach Zjednoczonych, niewielu zrobiło to tak dobrze jak ta. Oto książka, która formułuje zalecenia, przy niewielkiej liczbie przeglądów; mało tu jest zwykłej gadatliwości dotyczącej historii i etyki, moralności i edukacji, kontroli prawnych lub złych uczynków lekarzy, branży ubezpieczeniowej lub prawników. Redaktorzy pochodzą z Midwest Institute of Health Care and Law w Topeka, Kansas. Wszyscy mają wyższe wykształcenie lub wydziały, a dwóch to lekarze. Ich 11 współpracowników pochodzi z kilku innych stanów, a także z Wielkiej Brytanii i Nowej Zelandii. Read more „Rozwiązania medyczne dotyczące nadużyć: Systemy i propozycje rekompensat za szkody”

Randomizowany proces chirurgii w leczeniu pojedynczych przerzutów do mózgu ad 8

Niepowodzenia leczenia są dwojakiego rodzaju: nawroty w pierwotnym miejscu i nowe przerzuty w miejscach w mózgu innych niż pierwotny (odległe przerzuty). Przyczyny dwóch rodzajów awarii są prawdopodobnie inne. Nawrót w pierwotnym miejscu jest prawie na pewno spowodowany niepowodzeniem początkowego leczenia, aby całkowicie wyeliminować pierwotne przerzuty. Nawroty w odległych miejscach w mózgu mogą wynikać z nowych przerzutów rozprzestrzeniających się do mózgu po zakończeniu leczenia pierwotnego guza mózgu lub z obecności dodatkowych (ale niewykrytych) przerzutów do mózgu, które były obecne, ale nie zostały zniszczone przez radioterapię w tym czasie. pierwotne przerzuty do mózgu poddano leczeniu. Read more „Randomizowany proces chirurgii w leczeniu pojedynczych przerzutów do mózgu ad 8”

Próba różnych intensywności leczenia przeciwzakrzepowego u pacjentów z protezowymi zaworami serca cd

Badanymi zmiennymi były intensywność antykoagulacji, czas trwania leczenia oraz wiek, płeć i historia palenia, cukrzyca i migotanie przedsionków. Ponieważ żaden z pacjentów nie miał nadciśnienia, nie został uwzględniony w ostatecznej analizie. Względne ryzyko uzyskano ze współczynnika logistyczno-regresyjnego. Wyniki
Pacjenci
Tabela 1. Tabela 1. Read more „Próba różnych intensywności leczenia przeciwzakrzepowego u pacjentów z protezowymi zaworami serca cd”

Próba różnych intensywności leczenia przeciwzakrzepowego u pacjentów z protezowymi zaworami serca

THROMBOSIS wpływające na zastawki serca i tętnicze zakrzepowo-zatorowe pozostają głównymi przyczynami późnej zachorowalności i umieralności po zastąpieniu zastawek serca mechanicznymi protezami, pomimo ulepszenia konstrukcji zastawki.1 Czynniki wpływające na ryzyko wystąpienia tętniczej choroby zakrzepowo-zatorowej obejmują typ, miejsce i liczbę zastąpionych zastawek, 2 3 4 5 obecność lub brak migotania przedsionków, 6 leczenie warfaryną lub innymi doustnymi antykoagulantami, adekwatność terapii warfaryną, oraz dodanie leków przeciwpłytkowych, takich jak dipirydamol i aspiryna.1
Chociaż potrzeba leczenia przez całe życie warfaryny po mechanicznej wymianie zastawek, szczególnie w miejscu mitralnym (i prawdopodobnie w miejscu aorty), jest obecnie powszechnie akceptowana, pozostaje niepewność co do jej optymalnej intensywności.4, 7, 8 Ponieważ badania retrospektywne zdecydowanie sugerują że choroba zakrzepowo-zatorowa jest znacznie bardziej prawdopodobna, gdy efekt warfaryny jest niski lub nieobecny, zazwyczaj zalecano 7, 9 10 11 bardziej niż mniej intensywną terapię. W Europie terapia zwykle ma na celu międzynarodowy współczynnik znormalizowany (system standaryzacji wyników testów czasu protrombinowego wykonywanych z różnymi odczynnikami) od 3,0 do 5,0, aw Ameryce Północnej ma on na celu jeszcze wyższe poziomy, 12 jednak ostatnio wydaje się, że być zgodą na międzynarodowy znormalizowany stosunek pomiędzy 3,0 a 4,5 u pacjentów z mechaniczną zastawką protetyczną.13 Pytanie jest zarówno ważne, jak i aktualne, ponieważ ryzyko krwawienia wzrasta wraz z wyższymi poziomami antykoagulacji, a ponieważ badania z randomizacją wykazały, że profilaktyka wtórna po zakrzepicy żylnej wymaga mniej intensywnego efektu przeciwzakrzepowego (międzynarodowy współczynnik znormalizowany, od 2,0 do 2,5), niż wcześniej sądzono.
Przeprowadziliśmy prospektywne, otwarte badanie kliniczne, w którym pacjenci z zastawkami zastawki serca zostali losowo przydzieleni do terapii zaprojektowanej w celu uzyskania jednego z dwóch poziomów działania przeciwzakrzepowego: stosunek protrombiny do czasu (stosunek czasu protrombinowego pacjenta do czasu puli normalnej plazmy ) 1,5 (międzynarodowy współczynnik znormalizowany, 2,65) lub stosunek protrombinowy w czasie 2,5 (międzynarodowy współczynnik znormalizowany, 9). Wartości te odpowiadają skrajności przyjętego zakresu terapeutycznego w wielu ośrodkach15, 16
Metody
Pacjenci
Wszyscy pacjenci, którzy otrzymali mechaniczne zastawki protetyczne z powodu reumatycznej choroby serca i brali udział w klinice antykoagulacyjnej w latach 1981-1985 zostali losowo przydzieleni do jednej z dwóch grup terapeutycznych, które różniły się jedynie zamierzonym poziomem działania przeciwzakrzepowego (umiarkowane lub wysokie). Nie było żadnych wyjątków. Read more „Próba różnych intensywności leczenia przeciwzakrzepowego u pacjentów z protezowymi zaworami serca”

Wiadomości i numery: Przewodnik po zgłaszaniu roszczeń statystycznych i kontrowersji w dziedzinie zdrowia i dziedzin pokrewnych Zagrożenia dla zdrowia i prasa: Perspektywy medialnego zakresu oceny ryzyka i zdrowia ad

Początkującym reporterom nauki dobrze byłoby przeczytać Sortowanie przez plewę autorstwa Kotulaka. Zagrożenia dla zdrowia i prasa nie są dobrze związane; samo otwarcie jednej kopii prawie zerwało osłonę. Jest jednak dobrze zredagowany: eseje są czytelne i odpowiednio spójne pod względem formatu i nawiązują do siebie nawzajem. Znaczna część treści pojawiła się gdzie indziej. Dotyczy to na przykład materiału autorstwa Amesa na temat nieporozumień na temat zanieczyszczenia i raka, przez Nelkina na temat tego, jak prasa obejmuje naukę, oraz Cohna na temat oceny twierdzeń naukowców. Read more „Wiadomości i numery: Przewodnik po zgłaszaniu roszczeń statystycznych i kontrowersji w dziedzinie zdrowia i dziedzin pokrewnych Zagrożenia dla zdrowia i prasa: Perspektywy medialnego zakresu oceny ryzyka i zdrowia ad”

Pomyślna alogeniczna transplantacja zubożonego w komórki T szpiku kostnego z blisko dopasowanych HLA niespokrewnionych dawców ad 6

ANC oznacza bezwzględną liczbę neutrofilów. Na wykresie po lewej stronie w panelu B kropki przedstawiają liczbę komórek szpiku uzyskanych od dawcy (pod względem masy biorcy); na wykresie po prawej stronie kropki przedstawiają komórki zarodkowe szpiku kostnego podawane po rozdzieleniu komórek jednojądrzastych i wyczerpaniu limfocytów T. I słupki oznaczają średnie . SD. Diamenty reprezentują dawkę szpiku u pacjentów z niewydolnością przeszczepu: diament 1, pacjenci z niedokrwienną przeszczepioną przez stronę trzecią ; i diamenty 2 i 3, pacjenci z odrzuceniem za pośrednictwem komórki gospodarza. Read more „Pomyślna alogeniczna transplantacja zubożonego w komórki T szpiku kostnego z blisko dopasowanych HLA niespokrewnionych dawców ad 6”