Rola wariantów receptorów DP prostanoidu pod względem podatności na astmę czesc 4

Odtworzono produkt PCR z osobników z sekwencjami alternatywnych genotypów w celu potwierdzenia tożsamości genotypu w każdym teście. Analizę haplotypową regionu promotora PTGDR określono metodą PCR specyficznej dla allelu, a następnie analizą RFLP produktu. Zamplifikowano genomowy DNA przy użyciu startera specyficznego dla allelu wariantowego w T-549C (sensowny, 5 CCAGACGTGAGTTATCTTTACGC i antysensowny, 5 AACCTCCTATCTAAACTCGCGGGTCACACCCCTCTTCG) i trawiono fragmenty PCR stosując enzym restrykcyjny (TaqI dla T-197C i BsrDI dla C -441T), który był swoisty dla allelu typu dzikiego. W każdym teście kontrole znanej sekwencji były prawidłowo identyfikowane, a wyniki potwierdzono przez sekwencjonowanie podgrupy próbek.
Oznaczenie immunoprecypitacji chromatyny
Oznaczenia immunoprecypitacji chromatyny przeprowadzono zgodnie z metodą Boyda i wsp.19 przy użyciu dostępnego na rynku zestawu (Upstate) na ekstraktach jądrowych z komórek KU812 i eozynofilach z krwi obwodowej wyizolowanych metodą wirowania z gradientem gęstości i immunomagnetycznym selekcją CD16-ujemnym. Read more „Rola wariantów receptorów DP prostanoidu pod względem podatności na astmę czesc 4”

Deksametazon do leczenia gruźliczego zapalenia opon mózgowych u młodzieży i dorosłych ad

Autorzy doszli do wniosku, że niewielka liczba pacjentów, słabe ukrywanie przypisań do grup terapeutycznych i stronniczość publikacji może wyjaśniać pozytywne wyniki, oraz badania u pacjentów z zakażeniem wirusem HIV i badania o rozmiarze wystarczającym do oceny chorobowości i przypadku śmiertelności. stawka była wymagana.11 Dlatego przeprowadziliśmy podwójnie ślepe, kontrolowane placebo badanie, aby ustalić, czy terapia uzupełniająca deksametazonem poprawia wyniki u pacjentów w wieku powyżej 14 lat z gruźliczym zapaleniem opon mózgowo-rdzeniowych z zakażeniem HIV lub bez niego. Metody
Uczestnicy badania
Zwerbowaliśmy uczestników badania z dwóch ośrodków w Ho Chi Minh City w Wietnamie: Pham Ngoc Thach Hospital w Gruźlicy i Chorób Płuc oraz Szpitala Chorób Tropikalnych. Te 500-osobowe szpitale służą lokalnej społeczności i działają jako trzeciorzędne centra referencyjne dla pacjentów z ciężką gruźlicą (Pham Ngoc Thach Hospital) lub chorób zakaźnych (szpital dla chorób tropikalnych) w południowym Wietnamie.
Tylko pacjenci w wieku powyżej 14 lat z klinicznymi objawami zapalenia opon mózgowych (zdefiniowanymi jako połączenie sztywności karku i zaburzeń płynu mózgowo-rdzeniowego) kwalifikowali się do udziału w badaniu. Read more „Deksametazon do leczenia gruźliczego zapalenia opon mózgowych u młodzieży i dorosłych ad”

Przedoperacyjna i pooperacyjna chemioradioterapia raka odbytnicy

Pooperacyjna chemioradioterapia jest zalecaną standardową terapią u pacjentów z miejscowo zaawansowanym rakiem odbytnicy. W ostatnich latach odnotowano zachęcające wyniki przedoperacyjnej radioterapii. Porównaliśmy przedoperacyjną chemioradioterapię z pooperacyjną chemioradioterapią miejscowo zaawansowanego raka odbytnicy. Metody
Losowo przydzieliliśmy pacjentów z klinicznym stadium T3 lub T4 lub chorobą z dodatnim węzłem chłonnym, którzy otrzymywali przedoperacyjną lub pooperacyjną chemioradioterapię. Przedoperacyjne leczenie obejmowało 5040 cGy podawanych we frakcjach 180 cGy na dobę, pięć dni w tygodniu i fluorouracyl, podawane w 120-godzinnym ciągłym wlewie dożylnym w dawce 1000 mg na metr kwadratowy powierzchni ciała dziennie w ciągu pierwszy i piąty tydzień radioterapii. Read more „Przedoperacyjna i pooperacyjna chemioradioterapia raka odbytnicy”

Zdrowie i wzrost cywilizacji

Ta książka, jeśli jest zrobiona z przymrużeniem oka, jest użytecznym wprowadzeniem do antropologicznej historii choroby. Cohen przeprowadził badania archeologiczne nad neolityczną rewolucją – dramatyczne zmiany w życiu społecznym, które miały miejsce w czasie (ale niekoniecznie w odpowiedzi na) wprowadzenia rolnictwa. Jest to sprzeczne z intuicją, ale teraz przekonująco wykazano, że przejście to nie pociągnęło za sobą poprawy zdrowia, aw większości miejsc oznaczało spadek. Trzy kategorie dowodów są krótko przejrzane. Najpierw przedstawiono standardową historię ludzkiej egzystencji i form społecznych. Read more „Zdrowie i wzrost cywilizacji”

Wirusowe infekcje ludzi: epidemiologia i kontrola

Podobnie jak poprzednie edycje tej książki, trzecia edycja jest wieloautomatyczną pracą podzieloną na trzy sekcje. Pierwsza sekcja zawiera dwa rozdziały napisane przez redaktora, które wprowadzają podstawowe pojęcia i metody epidemiologiczne. Druga część – większa część książki – składa się z poszczególnych rozdziałów dotyczących głównych ludzkich chorób wirusowych, które są przedstawione w kolejności alfabetycznej. Pięć rozdziałów ostatniej części poświęcono nowotworom i chorobom ośrodkowego układu nerwowego, które są związane z utrzymującą się infekcją wirusową. Nowe rozdziały dotyczą hantawirusów, retrowirusów i raka wątrobowokomórkowego. Read more „Wirusowe infekcje ludzi: epidemiologia i kontrola”

Pomyślna alogeniczna transplantacja zubożonego w komórki T szpiku kostnego z blisko dopasowanych HLA niespokrewnionych dawców

ALLOGENEIC przeszczep szpiku kostnego jest coraz częściej stosowany w leczeniu nowotworów hematologicznych, zaburzeń niewydolności szpiku i chorób z wrodzonymi niedoborami, a dla wielu chorób jest obecnie leczeniem z wyboru.1, 2 Niestety, allogeniczny przeszczep jest w dużej mierze ograniczony do pacjentów z HLA identyczne z ich dawcami. Wraz ze spadkiem liczby rodzin w Ameryce Północnej i Europie Zachodniej, tylko około 30 do 35 procent pacjentów, którzy mogliby korzystać z przeszczepienia allogenicznego szpiku, ma rodzeństwo identyczne z HLA.3 Z tego powodu lekarze poszukiwali alternatywnych dawców szpiku, w tym osoby związane z biorcą i częściowo dopasowane do wyznaczników HLA i osób niepowiązanych, dobrze dopasowane do fenotypu HLA. Pierwsze wyniki allogenicznego przeszczepu szpiku z udziałem częściowo dobranych spokrewnionych dawców zostały zgłoszone przez kilka grup.4 5 6 7 8 9 10 11 Badania te wykazały, że w porównaniu z dobranymi genotypowo przeszczepami HLA, częściowo dobrane HLA przeszczepy od innych członków rodziny są skomplikowane ze względu na zwiększoną zachorowalność z powodu niewydolności przeszczepu, 4 5 6 7 8 9, 11 chorób przeszczep przeciwko gospodarzowi (GVHD), 4 5 6 7 8 9 10 11 12 i infekcji.4 5 6 7 8 9, 11, 12 Długoterminowe wskaźniki przeżywalności, szczególnie w przypadku przeszczepów od różniących się od HLA dawców, są w konsekwencji niższe niż w przypadku przeszczepów od genotypowo identycznych dawców.4, 7 Przeszczep szpiku z blisko dobranymi HLA niespokrewnionymi dawcami został ograniczony przez poważny problem logistyczny związany z rozwojem dawcy. rejestry wystarczająco duże, aby można było znaleźć blisko spokrewnione z HLA osoby niepowiązane.13 14 15 16 17 18 19 20 21 22 Kilka rejestrów lokalnych, regionalnych i krajowych dawców szpiku kostnego zostało utworzonych w celu zaspokojenia tej potrzeby, a ich dostępność poprawia prawdopodobieństwo znalezienia takich dawców.13 14 15 16 17, 19 20 21, 23 Korzystając z tych źródeł, kilka zespołów, w tym nasze własne, rozpoczęło transplantację szpiku z udziałem niespokrewnionych dawców, a wyniki wstępne zostały odnotowane. 24 25 26 27 28 29 30 31 32 33 34 Te doniesienia wykazały, że ciężka GVHD jest poważnym powikłaniem stosowania takich przeszczepów, występującym w 65 do 90 procentach procedur, w których do profilaktyki GVHD stosowano konwencjonalne schematy immunosupresyjne. Read more „Pomyślna alogeniczna transplantacja zubożonego w komórki T szpiku kostnego z blisko dopasowanych HLA niespokrewnionych dawców”

Staphylococcus aureus Przewód donosowy i infekcja u pacjentów z ciągłą ambulatoryjną dializą otrzewnową ad 5

Spośród 40 nosicieli S. aureus bez cukrzycy, 14 (35 procent) miało infekcje w miejscu wyjścia z S. aureus, a miało zapalenie otrzewnej S. aureus. W przeciwieństwie do siedmiu osób bez cukrzycy nie miało zakażenia w miejscu wyjścia i nie zapalenie otrzewnej z powodu S. Read more „Staphylococcus aureus Przewód donosowy i infekcja u pacjentów z ciągłą ambulatoryjną dializą otrzewnową ad 5”

Randomizowany proces chirurgii w leczeniu pojedynczych przerzutów do mózgu ad 9

Dzieje się tak, ponieważ tylko około 50 procent przerzutów do mózgu jest pojedynczych, a zatem potencjalnie resekcyjnych. Niestety, prawie połowa pacjentów z pojedynczymi przerzutami nie jest kandydatami do zabiegu z powodu niedostępności guza, obecności rozległej choroby ogólnoustrojowej lub innych czynników20. Pozostawia to około 25 procent wszystkich pacjentów z przerzutami do mózgu, którzy odnieśliby korzyść z chirurgii. resekcja; reszta powinna być leczona wyłącznie radioterapią. Pacjenci z przerzutami do mózgu, którzy są najbardziej narażeni na chirurgiczną resekcję to ci, którzy mają jedną operacyjnie dostępną zmianę, albo żadna pozostała choroba układowa (prawdziwe pojedyncze przerzuty) lub kontrolowany rak ogólnoustrojowy ograniczony do pierwotnego miejsca i oczekiwana długość życia co najmniej dwa miesiące. Read more „Randomizowany proces chirurgii w leczeniu pojedynczych przerzutów do mózgu ad 9”

Randomizowany proces chirurgii w leczeniu pojedynczych przerzutów do mózgu ad

Ponadto stopień choroby oceniano u wszystkich pacjentów; ocena ta składała się z filmu RTG klatki piersiowej, profili hematologicznych i chemicznych, tomografii komputerowej jamy brzusznej lub skanu z wątroby i śledziony radionuklidu oraz badania kości, jak wskazano klinicznie, oraz innych badań uznanych za odpowiednie dla pierwotnego guza pacjenta. W momencie rozpoznania przerzutów do mózgu wszyscy pacjenci otrzymywali deksametazon (4 mg co 6 godzin), który był kontynuowany przez cały okres radioterapii, a następnie przerwano leczenie. Pacjenci, którzy nie tolerowali ustania kortykosteroidów, utrzymywali najniższą możliwą dawkę. Przed randomizacją pacjenci byli stratyfikowani w zależności od umiejscowienia guza (supratentorial lub infratentorial), zakresu choroby (przerzuty w mózgu, przerzuty do mózgu i raka w pierwotnym miejscu, lub przerzuty do mózgu i raka w miejscu pierwotnym i co najmniej jeden dodatkowe miejsce) i rodzaj guza pierwotnego. Generowane komputerowo liczby losowe zostały następnie wykorzystane do przypisania pacjentów do jednej z dwóch grup leczenia (jedna grupa otrzymała zabieg chirurgiczny i radioterapię, a inna otrzymała tylko radioterapię). Read more „Randomizowany proces chirurgii w leczeniu pojedynczych przerzutów do mózgu ad”

Rozwiązania medyczne dotyczące nadużyć: Systemy i propozycje rekompensat za szkody czesc 4

Jest to efekt projektu Medical Liability Project Amerykańskiego Towarzystwa Medycznego, 31 krajowych stowarzyszeń medycznych i specjalistycznych oraz Rady Stowarzyszeń Medycznych. Udzieliłoby to zarządowi lub agencji uprawnienia do rozstrzygania sporów dotyczących odpowiedzialności medycznej. Może to być istniejąca medyczna rada dyscyplinarna lub nowa agencja (komisja ds. Rekompensat za wypadki) ustanowiona w tym celu. Przewiduje on trzystopniowy system rozpatrywania roszczeń: wstępne rozeznanie, decyzja zarządu i kontrola sądowa. Read more „Rozwiązania medyczne dotyczące nadużyć: Systemy i propozycje rekompensat za szkody czesc 4”