Rola wariantów receptorów DP prostanoidu pod względem podatności na astmę czesc 4

Odtworzono produkt PCR z osobników z sekwencjami alternatywnych genotypów w celu potwierdzenia tożsamości genotypu w każdym teście. Analizę haplotypową regionu promotora PTGDR określono metodą PCR specyficznej dla allelu, a następnie analizą RFLP produktu. Zamplifikowano genomowy DNA przy użyciu startera specyficznego dla allelu wariantowego w T-549C (sensowny, 5 CCAGACGTGAGTTATCTTTACGC i antysensowny, 5 AACCTCCTATCTAAACTCGCGGGTCACACCCCTCTTCG) i trawiono fragmenty PCR stosując enzym restrykcyjny (TaqI dla T-197C i BsrDI dla C -441T), który był swoisty dla allelu typu dzikiego. W każdym teście kontrole znanej sekwencji były prawidłowo identyfikowane, a wyniki potwierdzono przez sekwencjonowanie podgrupy próbek.
Oznaczenie immunoprecypitacji chromatyny
Oznaczenia immunoprecypitacji chromatyny przeprowadzono zgodnie z metodą Boyda i wsp.19 przy użyciu dostępnego na rynku zestawu (Upstate) na ekstraktach jądrowych z komórek KU812 i eozynofilach z krwi obwodowej wyizolowanych metodą wirowania z gradientem gęstości i immunomagnetycznym selekcją CD16-ujemnym. od osobników mających postacie promotora PTGDR, w których wiązanie czynnika transkrypcyjnego zaobserwowano w testach supershift mobilności elektroforetycznej. Warunki kontrolne wykluczyły przeciwciało lub genomowy DNA lub użyły nieistotnego przeciwciała. Dodatkowe szczegóły znajdują się w dodatkowym dodatku (dostępne wraz z pełnym tekstem tego artykułu na stronie www.nejm.org).
Analiza statystyczna
Główną zmienną wynikową analiz asocjacyjnych był status kontroli przypadku. Drugorzędnym wynikiem w obrębie grup pacjentów był całkowity poziom IgE w osoczu. Głównymi zmiennymi objaśniającymi były poszczególne warianty PTGDR lub ich haplotypy. Genotypy SNP podzielono na trzy klasy i analizowano kategorycznie, przy czym najczęstszy genotyp homozygotyczny dla każdego SNP stosowano jako kategorię odniesienia. Haplotypy analizowano kategorycznie, przy czym najpopularniejszym haplotypem był kategoria referencyjna. Dyplomy były analizowane kategorycznie w stosunku do wyjściowego dyplomu.
Każde locus SNP zostało ocenione pod kątem równowagi Hardy ego-Weinberga za pomocą tabeli kontyngencji obserwowanych częstotliwości genotypowych w porównaniu z przewidywanymi częstościami genotypów zgodnie ze zmodyfikowanym algorytmem losowego chodzenia łańcucha Markowa.20 Równowaga sprzężenia w parach pomiędzy każdą parą loci SNP była analizowane za pomocą testu ilorazu wiarygodności, którego rozkład empiryczny uzyskano za pomocą procedury permutacji21. Współczynnik nierównowagi Lewontina D oszacowano na podstawie bezpośrednio określonych (cząsteczkowych) częstotliwości haplotypów.
Analiza dwuwymiarowa wykorzystała analizę wariancji w celu porównania wyników ciągłych na wszystkich poziomach każdego testu genotypu lub haplotypu i .2 lub przybliżenia hybrydowego dokładnego testu Fishera22 na tabelach kontyngencji w celu porównania rozkładów zmiennych jakościowych w obrębie alleli, genotypów, haplotypów i dyplomów. Dla porównania aktywacji transkrypcyjnej, wyniki analizy wariancji, które były znaczące, były porównywane parami haplotypów.
Uogólnione modele liniowe (regresja liniowa i logistyczna) 23 zostały użyte do modelowania skutków wielu zmiennych towarzyszących dla wyników ciągłych i dychotomicznych, w tym badanie potrzeby interakcji lub terminów wielomianowych
[patrz też: furaginum ulotka, jagody goji opinie, ginko biloba ]
[patrz też: alkor nysa, leukodystrofia, mlokum ]