Rola wariantów receptorów DP prostanoidu pod względem podatności na astmę cd

ES Silverman, Uniwersytet Harvarda, Boston), 1,5 .g wektora podstawowego pGL3 niosącego haplotypiczny wariant CCT PTGDR i 500 ng wektora .-galaktozydazy z użyciem odczynnika Cellfectin (Invitrogen). 18 Aktywność świetlika lizatu i .- Aktywność galaktozydazy mierzono za pomocą układu do oznaczania enzymu .-galaktozydazy zgodnie z instrukcjami producenta. Aktywność lucyferazy świetlika została skorygowana o aktywność .-galaktozydazy w celu kontroli różnic w skuteczności transfekcji. Test zmiany ruchliwości elektroforetycznej
Ekstrakty jądrowe wytworzono z ludzkiej bazofilowej linii komórkowej KU812 (Japan Health Sciences Foundation) zgodnie z wcześniej opisanymi technikami17. Dwuniciowe oligonukleotydy zawierające następujące warianty promotora PTGDR zsyntetyzowano: -197T, 5 CAGAGCGTCCCGCCTCTCAAAGAGGGGTGT; -197C, 5 CAGAGCGTCCCGCCTCCCAAAGAGGGGTGT; -441C, 5 TCAAACACCAGCACCACTGCCCTCCTCTCAGGT; -441T, 5 TCAAACACCAGCACCATTGCCCTCCTCTCAGGT; -549T, 5 TGAGTTATCTTTACCTTTCCTTGACTAGCTA; i -549C, 5 TGAGTTATCTTTACCCTTCCTTGACTAGCTA. Oligonukleotydy znakowano izotopowo 5 -trifosforanem [.-32P] deoksycytydyny z enzymem fragmentu Klenowa i oczyszczano przez filtrację żelową. Reakcje wiązania między białkiem i DNA przeprowadzono za pomocą 5 do 10 .g białka ekstraktu jądrowego i .l znakowanego oligonukleotydu (50 000 cpm), .l polinukleotydu (kwas polideoksyinozynowy-deoksycytylowy) w 100 mM TRIS (pH 7,5), 10 mM EDTA. , 10 mM ditiotreitolu i 50% glicerolu w całkowitej objętości 20 .l. Po inkubacji w temperaturze pokojowej przez 30 minut, kompleksy białko-DNA rozdzielono na 7 procentach nie poddającym się kondensacji żelowi akrylamidowemu w buforze 0,5 x TRIS-boran-EDTA (44,5 mM TRIS, 44,5 mM kwasie borowym i mM EDTA) w temperaturze pokojowej. i wizualizowane przez autoradiografię. Eksperymenty Supershift i zimnej konkurencji przeprowadzono przez wstępną inkubację ekstraktów jądrowych z 2 .g specyficznych przeciwciał poliklonalnych lub nadmiernie wyżarzanych zimnych oligonukleotydów, odpowiednio, przez 10 minut przed dodaniem znakowanych sond.
Genotypowanie receptora DP i haplotypowanie
Ustaliliśmy częstotliwości SNP za pomocą analizy polimorfizmu długości fragmentów restrykcyjnych (RFLP). Wprowadziliśmy mutację (wskazaną przez podkreślenie), która wytworzyła restrykcyjne miejsce restrykcyjne enzymu w powstałym produkcie PCR, stosując zmodyfikowane startery, gdy te miejsca nie były obecne. Zastosowaliśmy następujące pary starterów oligonukleotydowych: T-549C, sensowny, 5 CCACGGGCAGATCACTTAAC i antysensowny, 5 GGCTTCTACCTAGTTGTCTTGAATTAGCTAGTCAAGCCA; C-441T, sensowny, 5 CGAGTTCTTGGCCACCCCAGTTCAAACACCAGCACAA i antysensowny, 5 GGAGCAGGCCAGTGAAGA; T-197C, sensowny, 5 ACTCGGCACCAGAGTCTGTC i antysensowny, 5 AACCTCCTATCTAAACTCGCGGGTCACACCCCTCTTCG; i G + 1044A, sensowny, 5 CGAGCCTTGCGATTTCTATC i antysensowny, 5 TCCTCAGCTTACCACAGAGTGA. PCR wykorzystywała polimerazę Taq zgodnie z instrukcjami producenta, z buforami zoptymalizowanymi pod kątem specyficzności amplifikacji i wydajności. Zamplifikowany DNA (10 .l) strawiono następnie enzymami restrykcyjnymi (cięcia TaqI T-197, cięcia MfeI -441T, cięcia BstNI -549C i cięcia BsrFI + 1044A). Strawione produkty PCR poddano elektroforezie na 1,5% żelu agarozowym zawierającym bromek etydyny i wizualizowano za pomocą transiluminacji w ultrafiolecie
[hasła pokrewne: fipronil, ile kosztuje rezonans magnetyczny, jagody goji działanie ]
[hasła pokrewne: vitamed opoczno, techkas, gratka konie zimnokrwiste ]